SGN Marker solcap_snp_sl_50467

SGN-M23997

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73253)
Chromosome
1
Position
45.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69144)
Chromosome
1
Position
41.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65503)
Chromosome
1
Position
57.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60328)
Chromosome
1
Position
69.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGTAAGAAGTTGAATGGCTCCCATTTTCTTCATGGATTTTGCAAACTCAA
  
3' flanking region
AAAGAAAGTCTTGTCTTTTAGTAATTTCTTGATGACAATTACTGAGTCTT
SNP nucleotide
TC
SNPdb format
CGTAAGAAGTTGAATGGCTCCCATTTTCTTCATGGATTTTGCAAACTCAA[T/C]
AAAGAAAGTCTTGTCTTTTAGTAATTTCTTGATGACAATTACTGAGTCTT
  
Genomic location of solcap_snp_sl_50467  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23997 marker 23997
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)