SGN Marker TG36

SGN-M24

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3200
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGTGCTCTGCAACTAATGGGATGTAAACCTCGACATGCGTTTAAGGTGATTTTTGAAAATGTGTTGGCTTTATGATCCGATTTATTCTCT
TTCGTTTCAATTTGTTTGCTCTGTTTTAAACTGAAGATGTGTAAAATGTATTAAAACAGATTAAAGAGGAGTATATGACAAATTATTTGA
TACTGATGGAGTACTGTTTTTAGTTTTGTATTTGGAATTTTTTTTCTTCCTTACTGTTTAACTTGCTCATTCATAATTGTTAGTCTCAGT
AATTGATTATGGTAAAAGCATTGTTGGGATGATAACAATTTATTCTTTGTTCTGTGAGCTGCCAATATCTAACTGATTAGTTATGAAAAG
GAAGTCTAATTAAGTATATATCTGGTCTATCTATTGTTTTTTTTTCAACAAGGTTGAAGTTTGAAAGTTTAGATTATTGGCTATATTGGT
GAAGTCGAGTTTTTTCCCCTAAAATTGTGTTCTGCCTGCGAATGAAATTTTAATGCCTT
Reverse sequence
CCACAAGAAAGATCCCTCCAGGTATAAGGCAAAATATGCAATATTTAAAATTACAAGTATTACCACAAAATTAAGGCTCAAATGTACACC
CTCCACAACGACGGATTCTTTCCGGTCTTCCCATGCAGTTATTAGCCTATCAAGACTATCAATTACCATCTCACTCTGTGCCTTAAATCC
TTCAACTGCCATTTCTCTGGAACTAATCAAATCAACAGCATTTGAAATCCGCACAGGTGGAGATTTTACACCTTCTTTTTGTATTGGTGG
GGTTGAAATACCAGCTAACTTCTTCGCCCTTTTCTTCGCTTTCGCTTCAGAAACAGCTACTGGATCCAAATATTCCCCAGCATGGTAGGT
TGAAGCCCAGAGTAAAGGGTTCTGCTTTTCATCTACAAAACTCCTCATCATATGTCGGATGGAGTCAGTGGACACCACAGTCGTTATACC
TAACCTGCTTCCCTGTGAAGATAAATGGAGAAGAAAATCATACACCTCATGTTTACACGGCAATCTTCCATTTCAGGAGATTTAACATCC
ACAATAATACACACCTCATGTCCCAATTCATAATTTTTTGAAATCATGCCATCAAAGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53856)
Chromosome
11
Position
16.40 cM
Confidence
uncalculated
Protocol
RFLP

Fruit_diameter_fd11_1 pH_pH11_1 Sugar_content_suc11_1 Fruit_weight_fw11_1 Lycopene_content_lyc11_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53545)
Chromosome
11
Position
102.77 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53282)
Chromosome
11
Position
42.73 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50376)
Chromosome
11
Position
51.49 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48310)
Chromosome
11
Position
102.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43861)
Chromosome
11
Position
88.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43604)
Chromosome
11
Position
73.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43323)
Chromosome
11
Position
76.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42447)
Chromosome
12
Position
116.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41632)
Chromosome
11
Position
115.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40821)
Chromosome
11
Position
83.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40012)
Chromosome
11
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 7787)
Chromosome
11a
Position
19.19 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7781)
Chromosome
11
Position
54.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Pepper-FAO3   
Map version
31 (location: 7786)
Chromosome
11a
Position
13.01 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 7783)
Chromosome
12
Position
114.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7782)
Chromosome
11
Position
73.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7780)
Chromosome
11
Position
43.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7789)
Chromosome
11
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG36 was used as an overgo probe on plate 11 [well E6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTGCTCTGCAACTAATGGGATGT
B sequence
ACGCATGTCGAGGTTTACATCCCA
AB sequence
AGTGCTCTGCAACTAATGGGATGTAAACCT
Marker sequence
AGTGCTCTGCAACTAATGGGATGTAAACCTCGACATGCGTTTAAGGTGAT
TTTTGAAAATGTGTTGGCTTTATGATCCGATTTATTCTCTTTCGTTTCAA
TTTGTTTGCTCTGTTTTAAACTGAAGATGTGTAAAATGTATTAAAACAGA
TTAAAGAGGAGTATATGACAAATTATTTGATACTGATGGAGTACTGTTTT
TAGTTTTGTATTTGGAATTTTTTTTCTTCCTTACTGTTTAACTTGCTCAT
TCATAATTGTTAGTCTCAGTAATTGATTATGGTAAAAGCATTGTTGGGAT
GATAACAATTTATTCTTTGTTCTGTGAGCTGCCAATATCTAACTGATTAG
TTATGAAAAGGAAGTCTAATTAAGTATATATCTGGTCTATCTATTGTTTT
TTTTTCAACAAGGTTGAAGTTTGAAAGTTTAGATTATTGGCTATATTGGT
GAAGTCGAGTTTTTTCCCCTAAAATTGTGTTCTGCCTGCGAATGAAATTT
TAATGCCTT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG36  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24 marker 24
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)