SGN Marker TG501

SGN-M240

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGTTTCTTGCTACTCTGTTTCTTTTGTTTCTCTCCAAATTTCTTCGCAAGAGGAAACTCAACTTACCTCCAGGCCCAAAACCATGGCCGA
TCATCGGAAATTTAAACCTTATGGGTTCCCTTCCTCACCGATCCATCCACGATCTCTCCGTCAAGTACGGACCCATTATGCAACTACAAT
TCGGGTCTTTTCCCGTCGTAGTTGGCTCCTCTGTAGAAATGGCCAAAATTTTCCTCAAAACCATGGATATCAACTTTGTTGGCAGGCCTA
AAACTGCTGCCGGAAAGTACACTACCTATAATTATTCAGATATTACATGGTCCCCGTACGGATCCTATTGGCGTCAGGCACGTAGAATGT
GCCTGATGGAATTGTTCAGCGCAAAACGGCTTGATTCATACGAGTACATTCGGGCTGAGGAACTTCATTCTATTC
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCAGGGATTCATCAGTGCAAGGTTAAATGAGAAAATTATCTTATACAAACAATGTATTTTATTTTTGA
GTTTAAGTTATATATATATATGGTCATTAATAATAAGAATAAAGTGAATACCTGAGTGAATGCTTTGACTCCATGTCTCTCCAGCTTAAC
ATCCAGAGTTGGATCATCAGCAAGCTGCAATAGAACATCCACCATGTCCTTAGCGACATAGTTTTCCACTGCGTTCCTTCTCATGTTATG
CTCATCAAGTACATGCTCCAGAAATTTGTCAAATTTCTTGCTTACAACTTTCATCCTCTTAACATAACCTTGTAGGTCCATGAAATCAAG
CCATGGAATTGAATCTCCAATATTAAGGACTCCATTAAGTAAGAACAATTCATCCAACATCTTTTTAAATTCATCAGGAGTCACAATCGA
GTTATCGGATTCGTCCAAGTAACTTTTTCCCAATACCAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1487375e-161433 (99.5% of RFLP seq)+
SGN-U148736435 (100.0% of RFLP seq)+
SGN-U1585903.3e-3981 (16.6% of RFLP seq)-
SGN-U1487371.2e-69171 (35.0% of RFLP seq)-
SGN-U1487362.3e-83171 (35.0% of RFLP seq)-
SGN-U1585901e-115209 (42.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8713)
Chromosome
3
Position
123.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG501 was used as an overgo probe on plate 2 [well D3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P097E21,   P026F12,   P173M23,   P022I12,   P189L05,   P089J19,   P080M20,   P135E10,   P241N01,   P240D07,   P235N04,   P271D20,   P033F13,   P331A15,   P316B04,   P164C11,   P034I02,   P167A16,   P286O17,   P192D11,   P151K03,   P046L21,   P199C24,   P282D14,   P214D20,   P071N07,   P073I14,   P140H22,   P271B10,   P103A22,   P113H10

 Overgo Sequences

A sequence
TTGTTGGCAGGCCTAAAACTGCTG
B sequence
GTAGTGTACTTTCCGGCAGCAGTT
AB sequence
TTGTTGGCAGGCCTAAAACTGCTGCCGGAA
Marker sequence
TGTTTCTTGCTACTCTGTTTCTTTTGTTTCTCTCCAAATTTCTTCGCAAG
AGGAAACTCAACTTACCTCCAGGCCCAAAACCATGGCCGATCATCGGAAA
TTTAAACCTTATGGGTTCCCTTCCTCACCGATCCATCCACGATCTCTCCG
TCAAGTACGGACCCATTATGCAACTACAATTCGGGTCTTTTCCCGTCGTA
GTTGGCTCCTCTGTAGAAATGGCCAAAATTTTCCTCAAAACCATGGATAT
CAACTTTGTTGGCAGGCCTAAAACTGCTGCCGGAAAGTACACTACCTATA
ATTATTCAGATATTACATGGTCCCCGTACGGATCCTATTGGCGTCAGGCA
CGTAGAATGTGCCTGATGGAATTGTTCAGCGCAAAACGGCTTGATTCATA
CGAGTACATTCGGGCTGAGGAACTTCATTCTATTC
Genomic location of TG501  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D240 marker 240
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)