SGN Marker solcap_snp_sl_51326

SGN-M24118

Synonyms  
SGN-U568735_snp900
SGN-U568735_snp900_solcap_snp_sl_51326
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70396)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66927)
Chromosome
4
Position
50.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60449)
Chromosome
4
Position
26.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATTTTGATCCACAAAATAATTATAATATATTAGAGTTGGTAAATATATA
  
3' flanking region
CCTCCGATTTATCTGGTGCAGTAATGAAACTCCTTAATGCCCGAAATTGG
SNP nucleotide
TC
SNPdb format
CATTTTGATCCACAAAATAATTATAATATATTAGAGTTGGTAAATATATA[T/C]
CCTCCGATTTATCTGGTGCAGTAATGAAACTCCTTAATGCCCGAAATTGG
  
Genomic location of solcap_snp_sl_51326  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24118 marker 24118
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)