SGN Marker solcap_snp_sl_51328

SGN-M24119

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73328)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65559)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60450)
Chromosome
4
Position
25.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATTCATCAACTACAAAATTCTCTACAACTTCTACATATCTGTCTCCACA
  
3' flanking region
ATTGACAGCCTCAGTCCTTAGCGTTACTTCTTCATTCTCATGGATAAACA
SNP nucleotide
AC
SNPdb format
GATTCATCAACTACAAAATTCTCTACAACTTCTACATATCTGTCTCCACA[A/C]
ATTGACAGCCTCAGTCCTTAGCGTTACTTCTTCATTCTCATGGATAAACA
  
Genomic location of solcap_snp_sl_51328  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24119 marker 24119
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)