Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_51374

SGN-M24126

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73334)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65561)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60457)
Chromosome
4
Position
21.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACGGTCTGTCTCCCGATTCATTCGTTGTCCTATCATAAATGCAGAAAG
  
3' flanking region
AGTGACTCACTTACATTAGATGATCCCATTTCTTCTACTTTCAATGGAAG
SNP nucleotide
AG
SNPdb format
TCACGGTCTGTCTCCCGATTCATTCGTTGTCCTATCATAAATGCAGAAAG[A/G]
AGTGACTCACTTACATTAGATGATCCCATTTCTTCTACTTTCAATGGAAG
  
Genomic location of solcap_snp_sl_51374  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24126 marker 24126
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)