Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_51429

SGN-M24135

Synonyms  
CL016754-0314
CL016754-0314_solcap_snp_sl_51429
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60466)
Chromosome
4
Position
14.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACAGTTCGGAGAGAACCACCATTGTTTATACCGCAAACATCAATAAGGT
  
3' flanking region
GAGATTCCACCTGACTACGTCAGGATCTAGCTCATAAAGAGTCATAAATT
SNP nucleotide
TG
SNPdb format
AACAGTTCGGAGAGAACCACCATTGTTTATACCGCAAACATCAATAAGGT[T/G]
GAGATTCCACCTGACTACGTCAGGATCTAGCTCATAAAGAGTCATAAATT
  
Genomic location of solcap_snp_sl_51429  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24135 marker 24135
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)