Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_51659

SGN-M24180

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60511)
Chromosome
4
Position
3.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATGATCAAGATTTAGGATTCTTTGCTAACTTTCTTGGCATCTTTATTT
  
3' flanking region
CGTATTTGTTATTGCTTATCATTATGTAGTGGCTGATCCCAAGTACTTGG
SNP nucleotide
TG
SNPdb format
GGATGATCAAGATTTAGGATTCTTTGCTAACTTTCTTGGCATCTTTATTT[T/G]
CGTATTTGTTATTGCTTATCATTATGTAGTGGCTGATCCCAAGTACTTGG
  
Genomic location of solcap_snp_sl_51659  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24180 marker 24180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)