SGN Marker solcap_snp_sl_52056

SGN-M24238

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73394)
Chromosome
10
Position
19.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69240)
Chromosome
10
Position
27.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65592)
Chromosome
10
Position
39.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60569)
Chromosome
10
Position
3.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTACTGCACATGATGCCAAGAACTCTATTACATTGTTACAAAAGAACCAA
  
3' flanking region
AGTCGTTATCGATAAGAAACATCACATAGTAACACTGAAAGAATTAACAA
SNP nucleotide
TG
SNPdb format
CTACTGCACATGATGCCAAGAACTCTATTACATTGTTACAAAAGAACCAA[T/G]
AGTCGTTATCGATAAGAAACATCACATAGTAACACTGAAAGAATTAACAA
  
Genomic location of solcap_snp_sl_52056  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24238 marker 24238
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)