SGN Marker solcap_snp_sl_52352

SGN-M24274

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60605)
Chromosome
3
Position
46.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAACCTTGATGGAGATACTCGAGTCCCTTGGCAATTCCTACAGATATTT
  
3' flanking region
TAACATCTTCTCCCAACCTAGTGATGATGACCCTCTTCCATTCCCTGATG
SNP nucleotide
AG
SNPdb format
GCAACCTTGATGGAGATACTCGAGTCCCTTGGCAATTCCTACAGATATTT[A/G]
TAACATCTTCTCCCAACCTAGTGATGATGACCCTCTTCCATTCCCTGATG
  
Genomic location of solcap_snp_sl_52352  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24274 marker 24274
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)