Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_52407

SGN-M24281

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73425)
Chromosome
12
Position
39.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60612)
Chromosome
12
Position
37.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAATGCAACTTCTTGGTGTTAGCATCTAACAGAAAAGTGTTATGCAGTCA
  
3' flanking region
TTAAGTTTCTGTGAAGCTAGAGAGATTTATAGGAGGTTGGCCAAAAAAGT
SNP nucleotide
TC
SNPdb format
AAATGCAACTTCTTGGTGTTAGCATCTAACAGAAAAGTGTTATGCAGTCA[T/C]
TTAAGTTTCTGTGAAGCTAGAGAGATTTATAGGAGGTTGGCCAAAAAAGT
  
Genomic location of solcap_snp_sl_52407  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24281 marker 24281
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)