SGN Marker solcap_snp_sl_52416

SGN-M24284

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73426)
Chromosome
12
Position
39.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69266)
Chromosome
12
Position
51.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60615)
Chromosome
12
Position
36.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGAGAGTTAGTCTACCACCATAGAAAGATATTGCCTCTGCCAAGTAGC
  
3' flanking region
AGCCTTTTCTCCACCTTCTTGATAACACTGCTCCAAATATCAATGGACTT
SNP nucleotide
TC
SNPdb format
GATGAGAGTTAGTCTACCACCATAGAAAGATATTGCCTCTGCCAAGTAGC[T/C]
AGCCTTTTCTCCACCTTCTTGATAACACTGCTCCAAATATCAATGGACTT
  
Genomic location of solcap_snp_sl_52416  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24284 marker 24284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)