SGN Marker solcap_snp_sl_52417

SGN-M24285

Synonyms  
CL016015-0237
CL016015-0237_solcap_snp_sl_52417
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60616)
Chromosome
12
Position
35.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTGAGACGCTGTCGAAGGCATGAGAGATCATCGCCGGAGATGAAGAGT
  
3' flanking region
CCCGGAGGGAGATGAGGCAAGTCTGGGATGGTTATCCGGGTCGGGTGCGA
SNP nucleotide
AT
SNPdb format
TTGTGAGACGCTGTCGAAGGCATGAGAGATCATCGCCGGAGATGAAGAGT[A/T]
CCCGGAGGGAGATGAGGCAAGTCTGGGATGGTTATCCGGGTCGGGTGCGA
  
Genomic location of solcap_snp_sl_52417  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24285 marker 24285
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)