SGN Marker TG504

SGN-M243

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTTCACAGTCTTCCAACTTTCTGCCAGATGAACGCAACTTTAAATTACAATCCCACAGATAGTCATCTTATTCAGAGTAATTGCCGATTC
AATTATGAAATACATATTTAGCAACAATGTGAATACTAAGATTTCAAATATTTTCGCCTGTTTAAGTGAGGGACTTCACATGTAAAGCAG
CAGAAGAGCATGTCAACCATGCATTGCTCACATTTGGAAAACAGAACATCTTTTAAGTTGTTCATTTGTTATGATAAAGCTTGTTGTGAT
GTACCCAAGCAATAACCAAACATTTATGAACTTACAAGGCAAGAATTTGAAGCACTAATGTTTCTTGACCGAGCTTCCTGTAAAGAATAG
CCTGTAATGAAACCATCAATAACACAAGGACTGCAAATCACAAGGAGAATAAAACAGTTCAAGCTGTTATCCAGCAGAGATGCATATGCC
ATTATTTCTA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAGATTAGAAGTTGGATTTGCCACCTTAAGAGTCTAGTCAGTGCTTGACATTATCTTCGTTCTAGTCT
GCACTTTGTTTTCAAACTGTGACCAAGTGTACTTTCTTTTAGTCTTGTAACTTTCTAGCTTTGTCTTACTTGGCAAATCCATTAAAAAGC
AGTCTTTTAGTAGATTAATGGTCTTACAGTTAACATTGAAGCACCAAGGCCACAAAACTATTCTAGTACTGGAAAAAGGTTTTAAGGTAA
AATATTTTTTTTTTGAAAAAAAGAAGTACTTTATTTTATTTTGAAATGGAACTTACTAATACTTGGAAATTTTCTTAGAAGGTTCTGTAG
TGTGACTTAGGCAGTTATGGACTAAAATATGGCCTTAGTAAATCATAAGGTGATACATAAACACAGTAAATTTATGGTTTTATTGTTTGA
CCTAGTATATCCATTAATGAATATGTCTTGATCATCTGTTGGC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50402)
Chromosome
5
Position
10.07 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48335)
Chromosome
5
Position
80.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43018)
Chromosome
5
Position
21.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44018
Forward primer (5'-3')
TAATGTTCTTGACCGAGCTTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATGGACTAAAATATGGCCTTAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40068)
Chromosome
5
Position
69.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8718)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG504 was used as an overgo probe on plate 14 [well B11]

Plausible BAC Matches:   P149L15,   P244F20,   P079L01,   P189I10,   P149J17,   P035O02,   P113D06,   P066F17,   P290E05,   P131A24,   P019J20,   P189K10,   P123B23,   P079K14,   P267L05

 Overgo Sequences

A sequence
AGTGAGGGACTTCACATGTAAAGC
B sequence
GACATGCTCTTCTGCTGCTTTACA
AB sequence
AGTGAGGGACTTCACATGTAAAGCAGCAGA
Marker sequence
CTTCACAGTCTTCCAACTTTCTGCCAGATGAACGCAACTTTAAATTACAA
TCCCACAGATAGTCATCTTATTCAGAGTAATTGCCGATTCAATTATGAAA
TACATATTTAGCAACAATGTGAATACTAAGATTTCAAATATTTTCGCCTG
TTTAAGTGAGGGACTTCACATGTAAAGCAGCAGAAGAGCATGTCAACCAT
GCATTGCTCACATTTGGAAAACAGAACATCTTTTAAGTTGTTCATTTGTT
ATGATAAAGCTTGTTGTGATGTACCCAAGCAATAACCAAACATTTATGAA
CTTACAAGGCAAGAATTTGAAGCACTAATGTTTCTTGACCGAGCTTCCTG
TAAAGAATAGCCTGTAATGAAACCATCAATAACACAAGGACTGCAAATCA
CAAGGAGAATAAAACAGTTCAAGCTGTTATCCAGCAGAGATGCATATGCC
ATTATTTCTA
Genomic location of TG504  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D243 marker 243
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)