SGN Marker solcap_snp_sl_530

SGN-M24361

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73470)
Chromosome
1
Position
58.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69297)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65645)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60692)
Chromosome
1
Position
73.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGGGGTCACGAAGCGAAAGGGGATTTATTGTTCCCAAACACCCGAAGG
  
3' flanking region
AAAGAAATGGATACAAAAACCTTAAAACTCTGAAAGGAGTACACGTTGTT
SNP nucleotide
AG
SNPdb format
CATGGGGTCACGAAGCGAAAGGGGATTTATTGTTCCCAAACACCCGAAGG[A/G]
AAAGAAATGGATACAAAAACCTTAAAACTCTGAAAGGAGTACACGTTGTT
  
Genomic location of solcap_snp_sl_530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24361 marker 24361
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)