SGN Marker solcap_snp_sl_53870

SGN-M24467

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73533)
Chromosome
1
Position
125.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69333)
Chromosome
1
Position
112.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65679)
Chromosome
1
Position
196.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60798)
Chromosome
1
Position
89.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCGGGTTAGATCCGATTATCATAGCTCCAGCACCATCACCAAAAAGAGC
  
3' flanking region
ACACCAACTAAATCATATGGCCTATCAACACTAGGTGGTTTGAACCCAAT
SNP nucleotide
AT
SNPdb format
ATCGGGTTAGATCCGATTATCATAGCTCCAGCACCATCACCAAAAAGAGC[A/T]
ACACCAACTAAATCATATGGCCTATCAACACTAGGTGGTTTGAACCCAAT
  
Genomic location of solcap_snp_sl_53870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24467 marker 24467
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)