SGN Marker solcap_snp_sl_53955

SGN-M24474

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73539)
Chromosome
12
Position
48.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69337)
Chromosome
12
Position
58.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65682)
Chromosome
12
Position
70.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60805)
Chromosome
12
Position
47.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTACCAATATTAAGGACAATCAGTTCCACTAGTCCCTTACTGTTCAT
  
3' flanking region
AGAAATCCAAGAGCAAGAGCTTCATTTTTCGGAATCTTCCAGAGAAGGGA
SNP nucleotide
AG
SNPdb format
TCTTTACCAATATTAAGGACAATCAGTTCCACTAGTCCCTTACTGTTCAT[A/G]
AGAAATCCAAGAGCAAGAGCTTCATTTTTCGGAATCTTCCAGAGAAGGGA
  
Genomic location of solcap_snp_sl_53955  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24474 marker 24474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)