Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_53990

SGN-M24477

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73542)
Chromosome
12
Position
47.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69339)
Chromosome
12
Position
58.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65684)
Chromosome
12
Position
69.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60808)
Chromosome
12
Position
47.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTCTCCAAGAGTAGATATGGTCACCTGATGCTATCTCGCTCCTTTCTA
  
3' flanking region
TTTGTGAGTGAGCAGACCCATCTCTTTCCCTCTCTGCAATCGCCAGAGTT
SNP nucleotide
TC
SNPdb format
AGTTCTCCAAGAGTAGATATGGTCACCTGATGCTATCTCGCTCCTTTCTA[T/C]
TTTGTGAGTGAGCAGACCCATCTCTTTCCCTCTCTGCAATCGCCAGAGTT
  
Genomic location of solcap_snp_sl_53990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24477 marker 24477
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)