Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_54024

SGN-M24480

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60811)
Chromosome
12
Position
47.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTTTGCACTTGAAGTTGCTCAGTTCTATACAGATTTGTATATGCGCAG
  
3' flanking region
GCATTCCTATCATCTATTTTACCTTCCAAACCAGATATAATTCTGTTCCT
SNP nucleotide
AG
SNPdb format
TCCTTTGCACTTGAAGTTGCTCAGTTCTATACAGATTTGTATATGCGCAG[A/G]
GCATTCCTATCATCTATTTTACCTTCCAAACCAGATATAATTCTGTTCCT
  
Genomic location of solcap_snp_sl_54024  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24480 marker 24480
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)