SGN Marker solcap_snp_sl_54128

SGN-M24490

Synonyms  
Le001035_37
Le001035_37_solcap_snp_sl_54128
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60821)
Chromosome
12
Position
64.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTCATTCCCATGCCCATGTTGTTCATAGGTCTGTTCATCCCCATGCCGC
  
3' flanking region
ATAAGGCTGGTTCCCTCCTCCATATGCTCCCATGCCAGGACCACCACCAG
SNP nucleotide
CG
SNPdb format
GTTCATTCCCATGCCCATGTTGTTCATAGGTCTGTTCATCCCCATGCCGC[C/G]
ATAAGGCTGGTTCCCTCCTCCATATGCTCCCATGCCAGGACCACCACCAG
  
Genomic location of solcap_snp_sl_54128  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24490 marker 24490
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)