SGN Marker solcap_snp_sl_55712

SGN-M24611

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73627)
Chromosome
12
Position
63.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69389)
Chromosome
12
Position
73.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65730)
Chromosome
12
Position
108.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60942)
Chromosome
12
Position
62.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGCGTTGACGTATCGCCGGAAATGTGACCGGAGAAGGTGAGATTACACC
  
3' flanking region
GAAAATTGGGACGATTGCTTGCCGGAGTGGGAGAGTGTGTAAACGGAGGA
SNP nucleotide
AG
SNPdb format
ATGCGTTGACGTATCGCCGGAAATGTGACCGGAGAAGGTGAGATTACACC[A/G]
GAAAATTGGGACGATTGCTTGCCGGAGTGGGAGAGTGTGTAAACGGAGGA
  
Genomic location of solcap_snp_sl_55712  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24611 marker 24611
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)