SGN Marker solcap_snp_sl_56156

SGN-M24657

Synonyms  
SL1_00sc6004_1145728
SL1_00sc6004_1145728_solcap_snp_sl_56156
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70560)
Chromosome
11
Position
76.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67061)
Chromosome
11
Position
81.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63527)
Chromosome
11
Position
95.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60988)
Chromosome
11
Position
51.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAGATCATGACTGATCGGAAGTGGAAAAATCCAGTTAGCAGCATAATA
  
3' flanking region
TGTTGTCTGATGGACAAGACACGTATACCATTAACAGTCCTAGTGTAGCT
SNP nucleotide
TC
SNPdb format
CCAAGATCATGACTGATCGGAAGTGGAAAAATCCAGTTAGCAGCATAATA[T/C]
TGTTGTCTGATGGACAAGACACGTATACCATTAACAGTCCTAGTGTAGCT
  
Genomic location of solcap_snp_sl_56156  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24657 marker 24657
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)