SGN Marker solcap_snp_sl_56161

SGN-M24660

Synonyms  
SL1_00sc6004_1122497
SL1_00sc6004_1122497_solcap_snp_sl_56161
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70557)
Chromosome
11
Position
76.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60991)
Chromosome
11
Position
51.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGGTATAGCTGAGCTTAAAGCTCTGGAGAATCTTATGGATGAAACTGA
  
3' flanking region
TCCGTTAACGGACAATTGGATAAAAATGCATCAGCTCCAGGCTCAGGCTT
SNP nucleotide
AG
SNPdb format
AAGGGTATAGCTGAGCTTAAAGCTCTGGAGAATCTTATGGATGAAACTGA[A/G]
TCCGTTAACGGACAATTGGATAAAAATGCATCAGCTCCAGGCTCAGGCTT
  
Genomic location of solcap_snp_sl_56161  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24660 marker 24660
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)