SGN Marker solcap_snp_sl_56172

SGN-M24664

Synonyms  
SL1_00sc6004_1025603
SL1_00sc6004_1025603_solcap_snp_sl_56172
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60995)
Chromosome
11
Position
51.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCTGACCCGCCTGTGCAGACCGTGACAGCCAAAGATGTTCATGGTGAAA
  
3' flanking region
TTGGAAGTTTAGGCACATTTATAGAGGTACTCCCAGGAGGCATTTGTTAA
SNP nucleotide
CG
SNPdb format
GGCTGACCCGCCTGTGCAGACCGTGACAGCCAAAGATGTTCATGGTGAAA[C/G]
TTGGAAGTTTAGGCACATTTATAGAGGTACTCCCAGGAGGCATTTGTTAA
  
Genomic location of solcap_snp_sl_56172  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24664 marker 24664
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)