SGN Marker solcap_snp_sl_56175

SGN-M24667

Synonyms  
CL015534-0232
CL015534-0232_solcap_snp_sl_56175
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60998)
Chromosome
11
Position
51.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATGTTCTGTCAGTGCTCCACAAGTAGTCCAAACAGGGAAAGACTTAGG
  
3' flanking region
AGGATACAACCGATCAACGAAAAACATCCTTCTGAGCAGAAAGGCAGCAT
SNP nucleotide
AC
SNPdb format
GGATGTTCTGTCAGTGCTCCACAAGTAGTCCAAACAGGGAAAGACTTAGG[A/C]
AGGATACAACCGATCAACGAAAAACATCCTTCTGAGCAGAAAGGCAGCAT
  
Genomic location of solcap_snp_sl_56175  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24667 marker 24667
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)