SGN Marker solcap_snp_sl_56187

SGN-M24668

Synonyms  
SL1_00sc6004_994731
SL1_00sc6004_994731_solcap_snp_sl_56187
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70635)
Chromosome
11
Position
75.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67111)
Chromosome
11
Position
80.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63577)
Chromosome
11
Position
94.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60999)
Chromosome
11
Position
51.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTGGTAGCTGAAGTAGAAGAAGAAGAGGAGGACAAAAGTTCAATCAATA
  
3' flanking region
ACAGAAAATGAGTGTGAGCAACGGTTCAGTTCATCCTGTTGACGCACCAC
SNP nucleotide
AT
SNPdb format
GTTGGTAGCTGAAGTAGAAGAAGAAGAGGAGGACAAAAGTTCAATCAATA[A/T]
ACAGAAAATGAGTGTGAGCAACGGTTCAGTTCATCCTGTTGACGCACCAC
  
Genomic location of solcap_snp_sl_56187  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24668 marker 24668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)