SGN Marker solcap_snp_sl_56232

SGN-M24672

Synonyms  
SL1_00sc6004_880100
SL1_00sc6004_880100_solcap_snp_sl_56232
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70633)
Chromosome
11
Position
74.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67109)
Chromosome
11
Position
78.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63575)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61003)
Chromosome
11
Position
51.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACGGGGAGGGACCTGGTGATGAAGTAGTTATTCTTGAATCACAAGTACT
  
3' flanking region
GGTGTCAAAAGGAAATTCACCCTCTTCGGTGTAGGCGTGAATGGTCTTTT
SNP nucleotide
AG
SNPdb format
CACGGGGAGGGACCTGGTGATGAAGTAGTTATTCTTGAATCACAAGTACT[A/G]
GGTGTCAAAAGGAAATTCACCCTCTTCGGTGTAGGCGTGAATGGTCTTTT
  
Genomic location of solcap_snp_sl_56232  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24672 marker 24672
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)