SGN Marker solcap_snp_sl_56296

SGN-M24682

Synonyms  
SL1_00sc6004_546602
SL1_00sc6004_546602_solcap_snp_sl_56296
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70630)
Chromosome
11
Position
71.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67106)
Chromosome
11
Position
77.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63572)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61013)
Chromosome
11
Position
50.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGAGAGATTCTTGACACCATAGATTTGAACTGAGAAAAAGATAAAGTT
  
3' flanking region
CACCATTATCAGCATCAAAAAACGCAGGTTTTTCAGGGTAAGATGAAATC
SNP nucleotide
TC
SNPdb format
CATGAGAGATTCTTGACACCATAGATTTGAACTGAGAAAAAGATAAAGTT[T/C]
CACCATTATCAGCATCAAAAAACGCAGGTTTTTCAGGGTAAGATGAAATC
  
Genomic location of solcap_snp_sl_56296  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24682 marker 24682
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)