SGN Marker solcap_snp_sl_56330

SGN-M24688

Synonyms  
SL1_00sc6004_307420
SL1_00sc6004_307420_solcap_snp_sl_56330
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61019)
Chromosome
11
Position
50.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCTCTGAACTACCAGTCTAAATACTACAAAAGACACCTATGCTGGCGC
  
3' flanking region
AGATTAGCTTCAGCTGGAGTAATGCCATTTTACTGGTTGTGGAACACCGA
SNP nucleotide
CG
SNPdb format
TTTCTCTGAACTACCAGTCTAAATACTACAAAAGACACCTATGCTGGCGC[C/G]
AGATTAGCTTCAGCTGGAGTAATGCCATTTTACTGGTTGTGGAACACCGA
  
Genomic location of solcap_snp_sl_56330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24688 marker 24688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)