SGN Marker solcap_snp_sl_57352

SGN-M24767

Synonyms  
CL016102-0429
CL016102-0429_solcap_snp_sl_57352
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61098)
Chromosome
6
Position
42.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAAAATGGGATTTTAATCCGTTGGAGCTAACTGACCCATACCCTCAAAA
  
3' flanking region
GAAAGCTCAGTTCACATCTGGCAAGGTGTCAAAGACAAAGTTGTGCCTGT
SNP nucleotide
TC
SNPdb format
GGAAAATGGGATTTTAATCCGTTGGAGCTAACTGACCCATACCCTCAAAA[T/C]
GAAAGCTCAGTTCACATCTGGCAAGGTGTCAAAGACAAAGTTGTGCCTGT
  
Genomic location of solcap_snp_sl_57352  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24767 marker 24767
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)