SGN Marker solcap_snp_sl_5738

SGN-M24772

Synonyms  
1909_2_45
1909_2_54_b
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65782)
Chromosome
12
Position
60.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61103)
Chromosome
12
Position
37.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAAACAGATTATGATCAAGTTGTATCAGAAGTTGGTGAAATGGCATCCT
  
3' flanking region
GATGTTCTGAGTATCAACAACATTAGGATATCGGAGTTTGTACCTAATTC
SNP nucleotide
TC
SNPdb format
GAAAACAGATTATGATCAAGTTGTATCAGAAGTTGGTGAAATGGCATCCT[T/C]
GATGTTCTGAGTATCAACAACATTAGGATATCGGAGTTTGTACCTAATTC
  
Genomic location of solcap_snp_sl_5738  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24772 marker 24772
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)