SGN Marker solcap_snp_sl_5787

SGN-M24811

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73732)
Chromosome
12
Position
40.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69462)
Chromosome
12
Position
51.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61142)
Chromosome
12
Position
44.08 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTTTTGTGATGATATCTCGAGGTTTCAAGTCCATCTTTAATAATTCCA
  
3' flanking region
AAGATATTTTCCCGCTAGGCGACACTCATCCAACTTTAGTGAGTCTTCAG
SNP nucleotide
TG
SNPdb format
CTTTTTTGTGATGATATCTCGAGGTTTCAAGTCCATCTTTAATAATTCCA[T/G]
AAGATATTTTCCCGCTAGGCGACACTCATCCAACTTTAGTGAGTCTTCAG
  
Genomic location of solcap_snp_sl_5787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24811 marker 24811
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)