SGN Marker solcap_snp_sl_57903

SGN-M24820

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61151)
Chromosome
9
Position
1.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGAGTCGGCCTAACAGATACAACAGTTTCTGGCAACATAAATGATTTTG
  
3' flanking region
AAGATTTAAATGGACGAAAACCACAAACTCAAAAATCAGCACGAAAAGTC
SNP nucleotide
AT
SNPdb format
ACGAGTCGGCCTAACAGATACAACAGTTTCTGGCAACATAAATGATTTTG[A/T]
AAGATTTAAATGGACGAAAACCACAAACTCAAAAATCAGCACGAAAAGTC
  
Genomic location of solcap_snp_sl_57903  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24820 marker 24820
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)