SGN Marker solcap_snp_sl_5795

SGN-M24825

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65806)
Chromosome
12
Position
60.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61156)
Chromosome
12
Position
44.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCGGCGGTGTACGAGGATGATGAGGAGTATGTAGAGGAGGAGGAGGAGG
  
3' flanking region
AGAAGAATTGTACGGGGAAGTTGAGGCTGTGGTTGAGGAAGCGGCTGAGG
SNP nucleotide
AT
SNPdb format
TGCGGCGGTGTACGAGGATGATGAGGAGTATGTAGAGGAGGAGGAGGAGG[A/T]
AGAAGAATTGTACGGGGAAGTTGAGGCTGTGGTTGAGGAAGCGGCTGAGG
  
Genomic location of solcap_snp_sl_5795  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24825 marker 24825
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)