SGN Marker solcap_snp_sl_58584

SGN-M24877

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73768)
Chromosome
3
Position
65.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69491)
Chromosome
3
Position
52.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65828)
Chromosome
3
Position
60.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61208)
Chromosome
3
Position
56.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTACAAATGTAGCTACAGGTGAAACTCCTAGAGTTGATGCAACTATTGT
  
3' flanking region
GATCCTGCATCAACCATATACGCGGTATATTCGCCTTCAAATTCTCCGTC
SNP nucleotide
TG
SNPdb format
TCTACAAATGTAGCTACAGGTGAAACTCCTAGAGTTGATGCAACTATTGT[T/G]
GATCCTGCATCAACCATATACGCGGTATATTCGCCTTCAAATTCTCCGTC
  
Genomic location of solcap_snp_sl_58584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24877 marker 24877
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)