SGN Marker solcap_snp_sl_58880

SGN-M24910

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73797)
Chromosome
12
Position
35.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69507)
Chromosome
12
Position
46.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65845)
Chromosome
12
Position
49.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61241)
Chromosome
12
Position
5.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGACTAACATCCTTCCATATTCCAGGTGACGCGTTTTCTCAAGTATCAA
  
3' flanking region
TATGAAAGACAGACATGAAATAGGATTAGCTTAACCAGTATTCTGCATTC
SNP nucleotide
AC
SNPdb format
ACGACTAACATCCTTCCATATTCCAGGTGACGCGTTTTCTCAAGTATCAA[A/C]
TATGAAAGACAGACATGAAATAGGATTAGCTTAACCAGTATTCTGCATTC
  
Genomic location of solcap_snp_sl_58880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24910 marker 24910
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)