SGN Marker solcap_snp_sl_58916

SGN-M24918

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69514)
Chromosome
4
Position
56.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65852)
Chromosome
4
Position
75.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61249)
Chromosome
4
Position
54.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGAAATTAAACTGTGGCAACCACAGCAGTGAGACAGCTCGGAGAAGAA
  
3' flanking region
AAGATGAAGATGACATGGAAGAATCAGAGCAAGAAGAACCCTAACAAAAG
SNP nucleotide
AG
SNPdb format
TTTGAAATTAAACTGTGGCAACCACAGCAGTGAGACAGCTCGGAGAAGAA[A/G]
AAGATGAAGATGACATGGAAGAATCAGAGCAAGAAGAACCCTAACAAAAG
  
Genomic location of solcap_snp_sl_58916  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24918 marker 24918
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)