SGN Marker solcap_snp_sl_58921

SGN-M24922

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69516)
Chromosome
4
Position
56.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65854)
Chromosome
4
Position
66.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61253)
Chromosome
4
Position
54.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCGTCTATAATAACACAGAGCAGCTCAGTGCACAAATCATCTCGTGTCA
  
3' flanking region
TTATATGTTTTGATACAACACTCACTTATTTCTAAAGAAGATAGATGATT
SNP nucleotide
TG
SNPdb format
AGCGTCTATAATAACACAGAGCAGCTCAGTGCACAAATCATCTCGTGTCA[T/G]
TTATATGTTTTGATACAACACTCACTTATTTCTAAAGAAGATAGATGATT
  
Genomic location of solcap_snp_sl_58921  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24922 marker 24922
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)