SGN Marker solcap_snp_sl_58931

SGN-M24928

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69521)
Chromosome
4
Position
56.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61259)
Chromosome
4
Position
54.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCTCTGCTGAATAATATTGAGAACGGACTCCGAGAAAGTTTCTTTAATG
  
3' flanking region
AAATGACAGCTGTTCTAATTCTGATGAGACTGGGAGAACTGCGGTTGACA
SNP nucleotide
CG
SNPdb format
ACCTCTGCTGAATAATATTGAGAACGGACTCCGAGAAAGTTTCTTTAATG[C/G]
AAATGACAGCTGTTCTAATTCTGATGAGACTGGGAGAACTGCGGTTGACA
  
Genomic location of solcap_snp_sl_58931  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24928 marker 24928
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)