Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_58944

SGN-M24934

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73815)
Chromosome
4
Position
47.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69524)
Chromosome
4
Position
55.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65859)
Chromosome
4
Position
66.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61265)
Chromosome
4
Position
54.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCTTGGAGCTGCCAAACCAAACTTTTCAGTCATGTCCAAATCAACAGG
  
3' flanking region
AATATGCCATCAGGCAAATCCCAATTGAAGCAATGTACTAATTGTGCAAC
SNP nucleotide
AT
SNPdb format
GCCCTTGGAGCTGCCAAACCAAACTTTTCAGTCATGTCCAAATCAACAGG[A/T]
AATATGCCATCAGGCAAATCCCAATTGAAGCAATGTACTAATTGTGCAAC
  
Genomic location of solcap_snp_sl_58944  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24934 marker 24934
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)