SGN Marker solcap_snp_sl_59183

SGN-M24958

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73832)
Chromosome
10
Position
47.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69536)
Chromosome
10
Position
52.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65871)
Chromosome
10
Position
85.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61289)
Chromosome
10
Position
61.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAATCCAAACAAAAGAAAATCTCAAGACTCTGATGGGTTGAAAAGTGATG
  
3' flanking region
AAGTATAGAAGCTAAATATTTATTTTTACAAGTGATGAATTTTTTTAATT
SNP nucleotide
AG
SNPdb format
CAATCCAAACAAAAGAAAATCTCAAGACTCTGATGGGTTGAAAAGTGATG[A/G]
AAGTATAGAAGCTAAATATTTATTTTTACAAGTGATGAATTTTTTTAATT
  
Genomic location of solcap_snp_sl_59183  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24958 marker 24958
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)