SGN Marker solcap_snp_sl_59236

SGN-M24964

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73836)
Chromosome
10
Position
49.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69539)
Chromosome
10
Position
54.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61295)
Chromosome
10
Position
61.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCTGAACTGGAAGTTGAGTTTGAAGCTTTAGCAGATGCAGGTCATGGCT
  
3' flanking region
AAGGCTGTTGAAACAAGGCCTTCCTTTGATTGCGAGTGTTGAGTCTATAC
SNP nucleotide
AG
SNPdb format
GCCTGAACTGGAAGTTGAGTTTGAAGCTTTAGCAGATGCAGGTCATGGCT[A/G]
AAGGCTGTTGAAACAAGGCCTTCCTTTGATTGCGAGTGTTGAGTCTATAC
  
Genomic location of solcap_snp_sl_59236  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24964 marker 24964
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)