SGN Marker solcap_snp_sl_59262

SGN-M24969

Synonyms  
SGN-U565581_snp1625
SGN-U565581_snp1625_solcap_snp_sl_59262
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70384)
Chromosome
10
Position
49.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66915)
Chromosome
10
Position
54.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63397)
Chromosome
10
Position
84.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61300)
Chromosome
10
Position
61.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGATATTCTCAAAAGAAAGCTAAAGATTTTGCCCCATATACATAAACAC
  
3' flanking region
TGTATTTAATTATACCTTTTTACAACTTTAACCATTAGACCATTTTTGAC
SNP nucleotide
AG
SNPdb format
TGGATATTCTCAAAAGAAAGCTAAAGATTTTGCCCCATATACATAAACAC[A/G]
TGTATTTAATTATACCTTTTTACAACTTTAACCATTAGACCATTTTTGAC
  
Genomic location of solcap_snp_sl_59262  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24969 marker 24969
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)