SGN Marker solcap_snp_sl_59437

SGN-M24979

Synonyms  
SGN-U562881_snp1158
SGN-U562881_snp1158_solcap_snp_sl_59437
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70369)
Chromosome
10
Position
56.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61310)
Chromosome
10
Position
61.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCATTGCACATGCTATTCATTACAACATTTTCTTGGTTTTGTACATGTT
  
3' flanking region
AACCTTGGGGCTTGCCTCTCTATATATAGTTTGAAGTGTGATTGAAACAT
SNP nucleotide
CG
SNPdb format
ATCATTGCACATGCTATTCATTACAACATTTTCTTGGTTTTGTACATGTT[C/G]
AACCTTGGGGCTTGCCTCTCTATATATAGTTTGAAGTGTGATTGAAACAT
  
Genomic location of solcap_snp_sl_59437  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24979 marker 24979
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)