SGN Marker solcap_snp_sl_5946

SGN-M24983

Synonyms  
Le021226_170
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73848)
Chromosome
11
Position
63.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61314)
Chromosome
11
Position
49.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAAGTGGAATTCTACTTCCCGGAGGCACGAAAAGTTTCTTAAAACTGAA
  
3' flanking region
GAATCTATGTTGTATAGCAGGTTTTGAGAAAAGTACCAGAAGTCATAGAT
SNP nucleotide
TG
SNPdb format
GCAAGTGGAATTCTACTTCCCGGAGGCACGAAAAGTTTCTTAAAACTGAA[T/G]
GAATCTATGTTGTATAGCAGGTTTTGAGAAAAGTACCAGAAGTCATAGAT
  
Genomic location of solcap_snp_sl_5946  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24983 marker 24983
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)