SGN Marker solcap_snp_sl_59474

SGN-M24989

Synonyms  
SGN-U580810_snp244
SGN-U580810_snp244_solcap_snp_sl_59474
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70458)
Chromosome
10
Position
56.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66988)
Chromosome
10
Position
59.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63464)
Chromosome
10
Position
89.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61320)
Chromosome
10
Position
62.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAATCTCTTTTTGTTCACCATTACACTCTTTTTCACCATTACAAGTGCC
  
3' flanking region
CATTTCAAGAAAACCCAAAATCCCCAATTTCAACAGTACCCCAAATCAAT
SNP nucleotide
AG
SNPdb format
CTAATCTCTTTTTGTTCACCATTACACTCTTTTTCACCATTACAAGTGCC[A/G]
CATTTCAAGAAAACCCAAAATCCCCAATTTCAACAGTACCCCAAATCAAT
  
Genomic location of solcap_snp_sl_59474  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24989 marker 24989
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)