SGN Marker solcap_snp_sl_5971

SGN-M25004

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65887)
Chromosome
11
Position
77.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61335)
Chromosome
11
Position
49.62 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTTTCATAATCGATTGTTGTAAAGATACAAACTTTGAGAGATTTAAGC
  
3' flanking region
TTTGAATTGTGGAATTTGGGTTGTGTTTGAAGAAATCGAAAGATTTGATA
SNP nucleotide
AC
SNPdb format
AGTTTTCATAATCGATTGTTGTAAAGATACAAACTTTGAGAGATTTAAGC[A/C]
TTTGAATTGTGGAATTTGGGTTGTGTTTGAAGAAATCGAAAGATTTGATA
  
Genomic location of solcap_snp_sl_5971  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25004 marker 25004
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)