SGN Marker solcap_snp_sl_5998

SGN-M25044

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73885)
Chromosome
11
Position
57.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69570)
Chromosome
11
Position
59.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65906)
Chromosome
11
Position
70.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61375)
Chromosome
11
Position
49.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAACCTCTGTTTTTGCTCTGTTTTTTGGGTTCTATCATCTTCTTAAAA
  
3' flanking region
CCCAAAGAAGATGAAATGGGGTTTTCGTTTGTTGGTGAAAAAATAACAAA
SNP nucleotide
AC
SNPdb format
AAAAACCTCTGTTTTTGCTCTGTTTTTTGGGTTCTATCATCTTCTTAAAA[A/C]
CCCAAAGAAGATGAAATGGGGTTTTCGTTTGTTGGTGAAAAAATAACAAA
  
Genomic location of solcap_snp_sl_5998  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25044 marker 25044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)