SGN Marker solcap_snp_sl_6002

SGN-M25050

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73891)
Chromosome
11
Position
57.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69576)
Chromosome
11
Position
59.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65912)
Chromosome
11
Position
70.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61381)
Chromosome
11
Position
49.11 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTTATTTCATCTGCAACAGCATCAATTCTGGAGGACACAGCCGAAGGG
  
3' flanking region
CATTTCCGTACATAGGTTTCCAGTCTTTTCCTCTCCACATCAATATCTGT
SNP nucleotide
CG
SNPdb format
TATTTATTTCATCTGCAACAGCATCAATTCTGGAGGACACAGCCGAAGGG[C/G]
CATTTCCGTACATAGGTTTCCAGTCTTTTCCTCTCCACATCAATATCTGT
  
Genomic location of solcap_snp_sl_6002  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25050 marker 25050
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)