SGN Marker solcap_snp_sl_60143

SGN-M25063

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73896)
Chromosome
1
Position
20.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69579)
Chromosome
1
Position
20.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65915)
Chromosome
1
Position
30.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61394)
Chromosome
1
Position
2.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATCGGTCTCAAATGCTTCAGCATCAACTCCTTCATTCTTCTCCATACAC
  
3' flanking region
TGTCATCTTGAAGGTCTTCATTTGCATTCGTGATTGCATCTTCCTCCGCG
SNP nucleotide
TC
SNPdb format
AATCGGTCTCAAATGCTTCAGCATCAACTCCTTCATTCTTCTCCATACAC[T/C]
TGTCATCTTGAAGGTCTTCATTTGCATTCGTGATTGCATCTTCCTCCGCG
  
Genomic location of solcap_snp_sl_60143  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25063 marker 25063
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)